ktrA [2019-12-27 11:15:59]

high affinity potassium channel KtrA-KtrB, peripheric membrane component

Locus: BSU_31090

Isoelectric point: 5.98

Molecular weight: 24.73 kDa

Protein length: 222 aa

Gene length: 669 bp

Function: potassium uptake

Product: high affinity potassium channel KtrA-KtrB, peripheric membrane component

Essential: no

Synonyms: yuaA

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Metal ion transporter
• Cellular processes → Homeostasis → Metal ion homeostasis (K, Na, Ca, Mg) → Potassium uptake/ export
• Information processing → Targets of second messengers → Targets of c-di-AMP
• Lifestyles → Coping with stress → Coping with hyper-osmotic stress
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,188,414 3,189,082

Phenotypes of a mutant

• a kimA ktrA ktrB mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source PubMed
• a ktrA-ktrB mutant of B. subtilis NCIB3610 is reduced in sliding (dendritic spreading) PubMed

The protein

Protein family

• KtrA potassium transport family (with KtrC, according to UniProt)

Paralogous protein(s)

• KtrC

Kinetic information

• the KtrA-KtrB channel has a high affinity for potassium,this is determined by KtrB PubMed

Domains

• contains a RCK_N domain at the N-terminus (aa 8-130) (according to UniProt)
• contains a RCK_C domain at the C-terminus (aa 139-222) (according to UniProt)

Effectors of protein activity

• binds ADP and ATP PubMed
• activity is inhibited upon binding of c-di-AMP PubMed

Structure

• 4J7C (the KtrA-KtrB complex) PubMed
• 4XTT (the S. aureus KtrA RCK_C domain in complex with c-di-AMP, 48% identity) PubMed
• 1LSU (complex with NADH)
• 2HMW ( complex with ATP)

Localization

• peripheral membrane protein PubMed

Expression and Regulation

Operons

• Genes: ktrA-ktrB
  Description: PubMed

  Regulatory mechanism

  • ydaO riboswitch: termination/antitermination, expression is switched off upon binding of c-di-AMP, in ydaO riboswitch

Additional information

• growth at extreme potassium limitation results in the acquisition of promoter mutations with increased ktrA-ktrB expression PubMed

Biological materials

Mutant

• MGNA-B543 (yuaA::erm), available at the NBRP B. subtilis, Japan
• 1A954 ( ktrA::kan), PubMed, available at BGSC
• GHB1 (ktrA-ktrB::aphA3), available in Erhard Bremer's lab
• GP92 (ktrA-ktrB::aphA3), available in Jörg Stülke's lab PubMed
• GP2083 (ktrA-ktrB::aphA3 ktrC::tet), available in Jörg Stülke's lab PubMed
• GP2498 (ktrA-ktrB::spc kimA::cat), available in Jörg Stülke's lab
• BKE31090 (ktrA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGTTCATATCTCCCTTA, downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
• BKK31090 (ktrA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGTTCATATCTCCCTTA, downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
• GP2716 (ktrA-ktrB::spc), available in Jörg Stülke's lab
• GP3065 (ktrA::kan), available in Jörg Stülke's lab

Expression vectors

• pGP2594: (IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844), available in Jörg Stülke's lab

LacZ fusion

• GP2176 (based on pAC5), available in Jörg Stülke's lab
• GP2177 (based on pAC7), available in Jörg Stülke's lab
• GP2299 (based on pAC6), available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

• Erhard Bremer, University of Marburg, Germany homepage

References

Reviews

Loading

Original publications

Loading